View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4044_low_10 (Length: 367)
Name: NF4044_low_10
Description: NF4044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4044_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 350
Target Start/End: Complemental strand, 10311473 - 10311124
Alignment:
| Q |
1 |
tggtgttacaaggacaagcggtatgtaattgatgaatctgtcgtgatttattgatgtattgatttgtttgagggatgagtgtttacatgaacttgtttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10311473 |
tggtgttacaaggacaagcggtatgtaattgatgaatctgtcgtgatttattgatgtattgatttgtttgagggatgagtgtttacatgaacttgtttga |
10311374 |
T |
|
| Q |
101 |
tatgattttgaatgcagtcatatgaaggaacatgagaagcagattgaaaaattgaggaagaggggtcttttggaccccgatagagctgatccattttcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10311373 |
tatgattttgaatgcagtcatatgaagaaacatgagaagcagattgaaaaattgaggaagaggggtcttttggaccccgatagagctgatccattttcgt |
10311274 |
T |
|
| Q |
201 |
cgtttatgaaaagtaaagaaataactcgtcgtttgtatgaggattctgaaaaaattctgggtagtacttttggaatgtgtatacttcaggtatcttacat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10311273 |
cgtttatgaaaagtaaagaaataactcgtcgtttgtatgaggattctgaaaaaattctgggtagtacttttggaatgtgtatacttcaggtatcttacac |
10311174 |
T |
|
| Q |
301 |
ttcttactagcttaattactttttcttgtctaagttgtctttctctttcc |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10311173 |
ttcttactagcttaattactttttcttgtctaagttgtctttctctttcc |
10311124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University