View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4044_low_13 (Length: 353)
Name: NF4044_low_13
Description: NF4044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4044_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 37 - 348
Target Start/End: Original strand, 41089980 - 41090303
Alignment:
| Q |
37 |
gaataaatgttaacgatcacatttatgttggcatatgtggtagggtgtttccatttgatcaacgtctaaaaatacttggaaatatgaatgatttataaac |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41089980 |
gaataaatgttaacgatcacatttatgttggcatatgtggtagggtgtttctatttgctcaacgtctaaaaatacttcgaaatatgaatgatttataaac |
41090079 |
T |
|
| Q |
137 |
aatg------------ctttaaattaatcccttccagatcaatgacaaggatgtggaaggagagataaggccaagaaaccatttttggcatatatattca |
224 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41090080 |
aatgcttatgaaaatgctttaaattaatcccttccagatcaatgacaaggatgtggaaggagagataaggccaagaaaccatttttggcatatatattca |
41090179 |
T |
|
| Q |
225 |
ttgttttgctgacttcttcctagctgcattgaattggcagatctatagactacacatgtttttgtttatgaataccagcaacattcatttgggatttcga |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41090180 |
ttgttttgctgacttcttcctagctgcattgaattcgcagatctatagactacacatgtttttgtttatgaatagcagcaacattcatttgggatttcga |
41090279 |
T |
|
| Q |
325 |
tcctcggctgccaaactctctgct |
348 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
41090280 |
tcctcggctgccaaactctttgct |
41090303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University