View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4044_low_20 (Length: 289)
Name: NF4044_low_20
Description: NF4044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4044_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 26922245 - 26921975
Alignment:
| Q |
1 |
tagagctgcattccgctgcaagagcgtgtccgaccattgtgtccctgatgtaacatactgttatccgatgccaccatttcaaagtcaccaacaaccaaac |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
26922245 |
tagagctgcattccgttgcaagagcgtgtccgaccactgtttccctgatgtaacatactgttatccgatgacaccatttcaaagccaccaacaaccaaac |
26922146 |
T |
 |
| Q |
101 |
catccggaagtcctcaaactgaatgtgaaattgtaaagccattattttgttacaataaaactacaaagacggaattttatcttttcagtgagaagtttca |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||| |
|
|
| T |
26922145 |
catctggaagtcctcaaactgaatgtgaaattgtaaagccattattttgttacaataaaactacaaggacagaattttatcttttcaatgagaagtttca |
26922046 |
T |
 |
| Q |
201 |
cattctgtttgagggcttcgagattgtgtggttgttcgtgaccttgaaatggccttgaaaccggtgtgttac |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
26922045 |
cattctgtttgagggcttcgagattgtgtggttgttcgtgaccttgaaatggcctt-aaaacggtgtgttac |
26921975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University