View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4045_high_28 (Length: 264)
Name: NF4045_high_28
Description: NF4045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4045_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 28 - 209
Target Start/End: Original strand, 13619583 - 13619758
Alignment:
| Q |
28 |
aataattgattatgtaaatactaaattgattgattaaatatttaatctaacatattcatttgnnnnnnnnnttaatctaatatattttcacaagttccaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||| ||||||||||||||| ||| |
|
|
| T |
13619583 |
aataattgattatgtaaatactaaattgattgatta-----ttaatctaacatattcatttgaaaaaaaa-ttaatataacatattttcacaagtttcaa |
13619676 |
T |
|
| Q |
128 |
gtctcctatgcacgacgtccaacattgactgccaatcccatgcagccatgttccaaagtgggtacaatgtgatcttatgata |
209 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13619677 |
gtctcctatgcacgatgtccaacattgactgccaatgccatgcagccatgttccaaagtgggtacaatgtgatcttatgata |
13619758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University