View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4045_high_36 (Length: 239)
Name: NF4045_high_36
Description: NF4045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4045_high_36 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 32016579 - 32016809
Alignment:
| Q |
19 |
atttcggtaagctcagtgtacaaggtgttggaggggttgttaattttagaggatggtttgaatcctgtggaggaaaaggtgtttgattacttttggaaaa |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
32016579 |
atttcggtaagctcaatgtacaaggtgttggaggggttgttaattttagaggatggtttgaatccggtggaggaagaggtgtttggttacctttggaaaa |
32016678 |
T |
|
| Q |
119 |
gcccggccccgtcaaaagttgtggctttttcttg----------cgtgatcggattcctacgggaggaatcttgccattcagaatttattggacccgaaa |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
32016679 |
gcccagccccgtcaaaagttgtggctttttcttggaaacttcttcgtaatcggattcctacaggagaaatcttgccattcagaatttattggatccgaaa |
32016778 |
T |
|
| Q |
209 |
agttcgaccaattgtgttttttgcgatgctt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32016779 |
agttcgaccaattgtgttttttgcgatgctt |
32016809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 110 - 153
Target Start/End: Original strand, 7425062 - 7425105
Alignment:
| Q |
110 |
tttggaaaagcccggccccgtcaaaagttgtggctttttcttgc |
153 |
Q |
| |
|
||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
7425062 |
tttggaagagcccggctcggtcaaaagttgtggctttttcttgc |
7425105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University