View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4045_high_37 (Length: 239)
Name: NF4045_high_37
Description: NF4045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4045_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 30 - 179
Target Start/End: Complemental strand, 12607732 - 12607583
Alignment:
| Q |
30 |
gcaaccataattgatcaagccgaacgtatagaactcaagtagctatttggccaaatacgtccgacaggctagaggtgttggccagaggggaggggaagaa |
129 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
12607732 |
gcaaccataattgatcaagtcgaacgtagagaactcaagtagctatttggccaaatacgtccgacaggctagaggtgttggccaaagaggaggggaagaa |
12607633 |
T |
 |
| Q |
130 |
agatgtgagggctcagaagcatgttagttagacacataagaaacagaatt |
179 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12607632 |
agatgtgggggctcagaagcatgttagttagacacataagaaacagaatt |
12607583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University