View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4045_high_38 (Length: 237)
Name: NF4045_high_38
Description: NF4045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4045_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 38021381 - 38021587
Alignment:
| Q |
1 |
tgccccccactattctaaatatttaataataagacattatgatcttttactccataacaaatattgaccagcatgacataaaatatcatctaggttttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38021381 |
tgccccccactattctaaatatttaataataagacattatgatcttttactccataacaaatattgaccagcatgacataaaatatcatctaggttttca |
38021480 |
T |
 |
| Q |
101 |
tctttcaatgtgatttaagggcaacaacatgcaatattaaccactcttcgagtgtcaccaactaagtgagagtagtgatagagcaacctcttcagccgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38021481 |
tctttcaatgtgatttaagggcaacaacatgcaatattaaccactcttcgagtgttaccaactaagtgagagtagtgatagagcaaccttttcagccgtg |
38021580 |
T |
 |
| Q |
201 |
gcaatgc |
207 |
Q |
| |
|
||||||| |
|
|
| T |
38021581 |
gcaatgc |
38021587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 67
Target Start/End: Complemental strand, 6459070 - 6459027
Alignment:
| Q |
24 |
taataataagacattatgatcttttactccataacaaatattga |
67 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
6459070 |
taataataagatattatgatcttttaccccacaacaaatattga |
6459027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University