View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4045_high_42 (Length: 214)
Name: NF4045_high_42
Description: NF4045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4045_high_42 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 32889347 - 32889168
Alignment:
| Q |
17 |
ttcttcttcaatgatattttatgtaaactttggaagataattctttctattatgtttggtaccttaagagacaacaatggatcatcaagaggtccaaatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32889347 |
ttcttcttcaatgatattttatgtaaagtttggaagataattctttctattatgtttggtaccttaagagacaacaatggatcatcaagaggtccaaatt |
32889248 |
T |
 |
| Q |
117 |
gcgacaatgatatttcagattgagtttatccattttgtccttcaaattacacccgatacaagatcattcattgtaggcaa |
196 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32889247 |
gtgacaatgatatttcagattgagtttatccattttgtccttcaaattacacccgatacaagatcattcattgtaggcaa |
32889168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University