View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4045_high_45 (Length: 210)
Name: NF4045_high_45
Description: NF4045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4045_high_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 40983171 - 40983367
Alignment:
| Q |
1 |
taatgatgtacctgcagttgatgagtcagacctgaccctgaagaagtttgaagaatatcaatctgagcttcaagaacttcaaaaggaaaaggtgattttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40983171 |
taatgatgtacctgcagttgatgagtcggacctgaccctgaagaagtttgaagaatatcaatctgagcttcaagaacttcaaaaggaaaaggtgattttg |
40983270 |
T |
 |
| Q |
101 |
gttttcacgtccaatattatattatctaatcacagatttgaaaactccatttgatttcatttacttaacaatgcatcgacagttttcttacattgct |
197 |
Q |
| |
|
||||||| |||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40983271 |
gttttcatgtccaatattatatcatctagtcgcagatttgaaaactccatttgatttcatttacttaacaatgcatcgacagttttcttacattgct |
40983367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University