View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4045_low_16 (Length: 438)
Name: NF4045_low_16
Description: NF4045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4045_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 17 - 428
Target Start/End: Original strand, 37826683 - 37827094
Alignment:
| Q |
17 |
caaaccccacctcatatacacaaatatatgtctcaattagcaaactcattttcgcgaggctagcgtttttcatgacctggagttctctgtagcttcggaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37826683 |
caaaccccacctcatatacacaaatatatgtctcaattagcaaactcattttcgtgaggctagcgtttttcatgacctggagttctctgtagcttcggaa |
37826782 |
T |
 |
| Q |
117 |
ctggggtcacgaaaaacttaacgacgacgaacatcttgctacaacgtcgccaccttgaagattcattgccggatcttgttggttctattacaaaatgtgc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37826783 |
ctggggtcacgaaaaacttaacgacgacgaacaccttgctacgacgtcgccaccttgaagattcattgccggatcttgttggttctattacaaaatgtgc |
37826882 |
T |
 |
| Q |
217 |
tttggtggttcgcaccgtttcacatttgtacttttcgttttggttctaaaaaccactataggcacaaccacggtggtcggttacttttcgatttgtgact |
316 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37826883 |
tttggtggttcgcactgtttcacatttgtactttttgttttggttctaaaaaccactataggcacaaccacggtggtcggttacttttcgatttgtgact |
37826982 |
T |
 |
| Q |
317 |
tcacagtggtgggtgatgaattggattgagtcggttgccgctgannnnnnncgtttgttcattgctacgatcatggttggcttgaaatagttgttaagct |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37826983 |
tcacagtggtgggtgatgaattggattgagtcagttgccgctgatttttttcgtttgttcattgctacgatcatggttggcttgaaatagttgttaagct |
37827082 |
T |
 |
| Q |
417 |
tactttcctttg |
428 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37827083 |
tactttcctttg |
37827094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University