View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4045_low_47 (Length: 222)
Name: NF4045_low_47
Description: NF4045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4045_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 21 - 213
Target Start/End: Complemental strand, 14863328 - 14863138
Alignment:
| Q |
21 |
ggggcactggttaacattctccttagattaaactaataaattattaagttgatcattgtctttgtaacacactcttaaactagactttgattgtattgat |
120 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14863328 |
ggggcactgattaacattctccttagattaaactagtaaattattaagttgatcgttgtctttgtaacacactctcaaactagactttgattgtattgat |
14863229 |
T |
 |
| Q |
121 |
atctcnnnnnnnngtctctctctttgttaagcgtttctcaattgagcccctctattagtatagttaatctaacattattaacagtgatgatgt |
213 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
14863228 |
atctc--aaaagagtctctgtctttgttaagcgtttctcaattgagcccctctattagtatagttcatctaacattgttaacagtgatgatgt |
14863138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University