View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4045_low_49 (Length: 220)
Name: NF4045_low_49
Description: NF4045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4045_low_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 12226401 - 12226213
Alignment:
| Q |
18 |
cattattaacaacgaccctg---acttgaaccaacaccatgttacaggtagctggaatagtatttggaatcttgaaattgccaccgaaagttaagaattt |
114 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12226401 |
cattattaacaacgaccctgcagacttgaaccaacaccatgttacaggtagctggaatagtatttggaatct-gaaattgccaccgaaagttaagaattt |
12226303 |
T |
|
| Q |
115 |
tatgtggcgtgcttgccgtaactgtttaccaacacgagggtcaaacttcatagtcgcggtgtccaatgccacacgaactgtgctgtctgtgc |
206 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12226302 |
tatgtggcgttcttgccgtaactgtttacca--acgagggtcaaacttcatagtcgcggtgtccaatgccccacgaactgtgctgtctgtgc |
12226213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 46 - 135
Target Start/End: Original strand, 30465810 - 30465898
Alignment:
| Q |
46 |
caacaccatgttacaggtagctggaatagtatttggaatcttgaaattgccaccgaaagttaagaattttatgtggcgtgcttgccgtaa |
135 |
Q |
| |
|
||||||| ||| |||||| ||||||| |||| |||| | || |||||||| ||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
30465810 |
caacaccgtgtgccaggtaactggaattgtatctggagt-ttaaaattgcccccgaaagttaagaatttcctttggcgagcttgccgtaa |
30465898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 40 - 200
Target Start/End: Complemental strand, 42927703 - 42927546
Alignment:
| Q |
40 |
ttgaaccaacaccatgttacaggtagctggaatagtatttggaatcttgaaattgccaccgaaagttaagaattttatgtggcgtgcttgccgtaactgt |
139 |
Q |
| |
|
||||||||||||| ||| | || |||||||| ||||| ||||| || ||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42927703 |
ttgaaccaacaccgtgtaaatggaagctggaacagtatatggaacct-gaaattgccgccgaaagttaagaattttatgtggcgtgcttgccgtaattgc |
42927605 |
T |
|
| Q |
140 |
ttaccaacacgagggtcaaacttcatagtcgcggtgtccaatgccacacgaactgtgctgt |
200 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| || ||||||| || | |||||||||| |
|
|
| T |
42927604 |
ttaccaacacga--gtcaaacttcaaagtcgcggcgttcaatgccccatggactgtgctgt |
42927546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University