View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4046_low_13 (Length: 328)
Name: NF4046_low_13
Description: NF4046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4046_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 53174289 - 53174103
Alignment:
| Q |
17 |
atgttttgtagacatttggcaccagaatactacttgcatggagttgtggatgagaaaacagatgtgtttgcttttggtgtgttcttgctagaagtcattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
53174289 |
atgttttgtagacatttggcaccagaatactacttgcatggagttgtggatgagaaaacagatgtatttgcttttggtgtgttcttgctagaagtcattt |
53174190 |
T |
|
| Q |
117 |
ctggtaggaaacctgtggatgtgtctcaccaaagtttacatagctgggtaagtaagtagagtagagtagagtagactagccccacttttgat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53174189 |
ctggtaggaaacctgtggatgtgtctcaccaaagtttacatagctgggtaagtaagtagagtagag-----tagactagccccacttttgat |
53174103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University