View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4047_high_6 (Length: 318)
Name: NF4047_high_6
Description: NF4047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4047_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 12 - 303
Target Start/End: Complemental strand, 24165623 - 24165330
Alignment:
| Q |
12 |
aagaaacagaactggagcagttgaaagctgggaatgctcgaaacatttcagagtctccaaaacgaagagctgtttcaccttaccatttgcccagatatgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24165623 |
aagaaacagaactggagcagttgaaagctgggaatgctcgaaacatttcagagtctccaaaacgaagagctgtttcaccttaccatttgcccagatatgg |
24165524 |
T |
|
| Q |
112 |
caccagtggcagcatgaagcctgaaactagtcaacgagtcatggatgatagaaaccttgaggttattgaacaattccatactcaattc--taggaatctg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||| |||||||||| |
|
|
| T |
24165523 |
caccagtggcagcatgaagcctgaaactagtcaacgagtcatggatgatagaaatcttgaggttattgaataattccgtactcaattctataggaatctg |
24165424 |
T |
|
| Q |
210 |
tataagagttcatttggaaaccatgccatatcgaatcataatttgtacattctctcaataacttcatctgaaactatattttcaggctagaagt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24165423 |
tataagagttcatttggaaaccatgccatatcgaatcataatttgtacattctctcaataacttcatctgaaactatattttcaggctagaagt |
24165330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 71 - 181
Target Start/End: Complemental strand, 42233525 - 42233415
Alignment:
| Q |
71 |
aaacgaagagctgtttcaccttaccatttgcccagatatggcaccagtggcagcatgaagcctgaaactagtcaacgagtcatggatgatagaaaccttg |
170 |
Q |
| |
|
|||| ||||||||||||||||| || | |||||| |||| | ||||||||||||||||||||||||| ||||||| || |||||||||||||| | || |
|
|
| T |
42233525 |
aaaccaagagctgtttcacctttccgtatgcccaaatatagtaccagtggcagcatgaagcctgaaaatagtcaaagatccatggatgatagaagctctg |
42233426 |
T |
|
| Q |
171 |
aggttattgaa |
181 |
Q |
| |
|
||||||||||| |
|
|
| T |
42233425 |
aggttattgaa |
42233415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University