View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4047_low_10 (Length: 250)
Name: NF4047_low_10
Description: NF4047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4047_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 44382110 - 44382354
Alignment:
| Q |
1 |
tcttaacctcgtcatctc--gtgttgtattggattggattcataagatgatgaaggaagggtcttccatggagaagggggaaacactgaaatccattgat |
98 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44382110 |
tcttaacctcgtcatctcttgtgttgtattggattggattcataagatgatgaaggaagggtcttccatggagaagggggaaacactgaaatccattgat |
44382209 |
T |
|
| Q |
99 |
tgttaaaggattttccattctattgaatgcacatgatttggctatggaggttggtgcaattcccatgatgacagtagcaaagttgcatttagtgtgtgat |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44382210 |
tgttaaag-attttccattctattgaatgcacatgatttg-ctatggaggttggtgcaattcccatgatgacagtagcaaagttgcatttagtttgtgat |
44382307 |
T |
|
| Q |
199 |
attcaaatcacatttgactgctggagctaccattgattcatctcact |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
44382308 |
attcaaatcacatttgactgctggagctacaattgattcatgtcact |
44382354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University