View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4047_low_12 (Length: 236)
Name: NF4047_low_12
Description: NF4047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4047_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 19843118 - 19843340
Alignment:
| Q |
1 |
atgaaatatcgatcttcatcctctcagatgtcttccctttcttctggattattaaaaaatatgtcttccttttcttcttaattattaaaaaatcttgttg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
19843118 |
atgaaatatcaatcttcatcctctcagatgtcttccctttcttctcgattattaaaaaatatgtcttccttttcttctgaaatattaaaaaatcttgttg |
19843217 |
T |
 |
| Q |
101 |
ggatatgcgagtctccgcttaatgtctttcctttcttctagattatt--nnnnnnntgtccatattcctagactttttatatactaactcttatgagtaa |
198 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19843218 |
ggatatgtgagtctccccttaatgtctttcctttcttctagattattaaaaaaaaatgtccatattcctagactttttatatcctaactcttatgagtaa |
19843317 |
T |
 |
| Q |
199 |
ataactttatttattgttactag |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
19843318 |
ataactttatttattgttactag |
19843340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University