View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4047_low_4 (Length: 336)
Name: NF4047_low_4
Description: NF4047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4047_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 117 - 319
Target Start/End: Original strand, 9388348 - 9388550
Alignment:
| Q |
117 |
ttgatgtctagcatatatcttttcttaatgaggaaaactaagcattctatttgtgacacttattcaggttcatacaatgtttctttatccttgtcaacat |
216 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9388348 |
ttgatgtctagcatatctcttttgttaatgaggaaaactaagcattctatttgtgacacttattcaggttcatgcaatgtttctttatccttgtcaacat |
9388447 |
T |
 |
| Q |
217 |
caaagagaataactctttttctatcacatgatcgaatatttacgggttttaaatgtttcacataccaatcaagagcctacaaagtaaatagagaatataa |
316 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9388448 |
caaagagaataactctttttctgtcacatgatagaatatttacgggttttaaatgtttcacataccaatcaagagcctacaaagtaaatagagaatataa |
9388547 |
T |
 |
| Q |
317 |
att |
319 |
Q |
| |
|
||| |
|
|
| T |
9388548 |
att |
9388550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 8 - 63
Target Start/End: Original strand, 9388239 - 9388294
Alignment:
| Q |
8 |
gacatcatcacatctttgcttgttttagcagttctcatattaatacaacttatacg |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9388239 |
gacatcatcacatctttgcttgttttagcagttctcatattaatacaacttatacg |
9388294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University