View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4047_low_8 (Length: 281)
Name: NF4047_low_8
Description: NF4047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4047_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 19 - 192
Target Start/End: Original strand, 54951169 - 54951344
Alignment:
| Q |
19 |
aagaaaagtttgtttaccaaacacttttcatttgatcaaataagcttatataagttagttcaataaattattaatctatctaaccacaagaatcatcgat |
118 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54951169 |
aagaaaagtttatttagcaaacacttttcatttgatcaaacaagcttatataagttagttcaataaattattaatctatctaaccacaagaatcatcgat |
54951268 |
T |
|
| Q |
119 |
t-aactgttgggattttgtattatgatatttt-tctcacttttatatgcccttcgtccgtttcttattcatctcat |
192 |
Q |
| |
|
| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54951269 |
tcaactgttgggattttgtattatgatattttatctcacttttatatgcccttcgtccgtttcttattcatctcat |
54951344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 68
Target Start/End: Complemental strand, 46334737 - 46334697
Alignment:
| Q |
28 |
ttgtttaccaaacacttttcatttgatcaaataagcttata |
68 |
Q |
| |
|
||||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
46334737 |
ttgtttaccaaacacgtctcatttgatcaaacaagcttata |
46334697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University