View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4048_high_13 (Length: 242)
Name: NF4048_high_13
Description: NF4048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4048_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 225
Target Start/End: Complemental strand, 14105622 - 14105411
Alignment:
| Q |
14 |
gaatggtgaagcctaagaggggtgacaacttatttacttcttcaatgacaagttcacttgaagtaaataaatagccaatttgtctacgaaatatcataat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14105622 |
gaatggtgaagcctaagaggggtgacaacttatttacttcttcaatgacaagttcacttgaagtaaataaatagccaatttgtctacgaaatatcataat |
14105523 |
T |
|
| Q |
114 |
caagagccagaagaaaacacttattataattgatgtcaccactgccactgctgaagcaaactttgctgcttgaccatttcctgctcctagctcgtttgcc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14105522 |
caagagccagaagaaaacacttattataattgatgtcaccactgccactgctgaagcaaactttgctgcttgaccatttcctgctcctagctcgtttgct |
14105423 |
T |
|
| Q |
214 |
acccttactctg |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14105422 |
acccttactctg |
14105411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University