View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4048_low_4 (Length: 519)
Name: NF4048_low_4
Description: NF4048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4048_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 4e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 13263242 - 13263429
Alignment:
| Q |
10 |
attattctcaaaattaccaactcagaacacatgttattatgaaaaaacaaatttaaacagcttaaatagtccacaatagtttaagtagtccctgatctag |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13263242 |
attattctcaaaattaccaactcagaaca--------tatgaaaaaacaaatttaaacagcttaaatagtccacaatagtttaagaagtccctgatctag |
13263333 |
T |
|
| Q |
110 |
tctagaaataatagttaaaaatagtctaatagtccatattggagggattaaattaagtttcacatattcttggagagtaaggtcctttttgtctcatact |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13263334 |
a--------aatagttaaaaatagtctaatagtccatatttgagggattaaattaagtttcacatattcttggagagtaaggtcctgtttgtctcatact |
13263425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 248 - 320
Target Start/End: Original strand, 13263464 - 13263536
Alignment:
| Q |
248 |
cgaaggggattttgtcacttataatttgaagttannnnnnnatcgatttcttaaagaaacaaactattttaga |
320 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13263464 |
cgaaggtgattttgtcatttataatttgaagttatttttttatcgatttcttaaagaaacaaactattttaga |
13263536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University