View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4049_high_34 (Length: 241)

Name: NF4049_high_34
Description: NF4049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4049_high_34
NF4049_high_34
[»] chr7 (1 HSPs)
chr7 (18-230)||(2700991-2701203)
[»] chr3 (1 HSPs)
chr3 (18-62)||(10843552-10843596)


Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 2700991 - 2701203
Alignment:
18 ctgccacttatcaccttctccttccattgatagtttcaagaaagatagaggcagagttttgttgtttgctacttcttagtttaccaagactatggacaat 117  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
2700991 ctgccacttatcaccttcaccttccattgatagtttcaagaaagatagaggtagagttttgttgtttgctacttcttagtttaccaagactatggacaat 2701090  T
118 gcttatctcttattcagaaataataataataatctttagtgcacttcgtttttctttttatagattgactcttttgatgagataagttagtttatgttgg 217  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
2701091 gtttatctcttattcagaaataataataataatctttagtgcacttcgtttttctttttatagattggctcttttgatgagataagttagtttatgttgg 2701190  T
218 atagatataagta 230  Q
    |||| ||||||||    
2701191 ataggtataagta 2701203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 10843552 - 10843596
Alignment:
18 ctgccacttatcaccttctccttccattgatagtttcaagaaaga 62  Q
    |||||||||||||||||||||||||||||||| ||||||| ||||    
10843552 ctgccacttatcaccttctccttccattgatattttcaaggaaga 10843596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University