View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4049_high_36 (Length: 239)
Name: NF4049_high_36
Description: NF4049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4049_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 7622630 - 7622844
Alignment:
| Q |
19 |
cgatcatctataactaagctatt--ttgtgtaatcaacaattttaaatccgattagcagccaaaattcagaattgggtgtaaccacatgtgnnnnnnnnn |
116 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7622630 |
cgatcatctataactaagctattgattatgtaatcaacaattttaaatccgattagcagccaaaattcagaattgggtgtaaccacatgtgttttttttt |
7622729 |
T |
 |
| Q |
117 |
acggcaaacgatccgagtatggtttgaagatcttttgaaggcatcacatttgaaccaatcaattgaagtataatggcatgtcaagaggaccactttgatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7622730 |
acggcaaacgatccgagtatggtttgaagatcttttgaaggcatcacatttgaaccaatcaattgaagtataatggcatgtcaataggaccactttgatt |
7622829 |
T |
 |
| Q |
217 |
atccgttttcttctc |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7622830 |
atccgttttcttctc |
7622844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University