View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4049_high_39 (Length: 238)
Name: NF4049_high_39
Description: NF4049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4049_high_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 39600690 - 39600894
Alignment:
| Q |
18 |
agtacctcaaattacaggttcatctttgtttagtactatgctaaaagg--attcaaagt--ttattcattttctgactcatgaatgttttttgttcacaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| | | ||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
39600690 |
agtacctcaaattacaggttcatctttgtttagtactatgctaaaagtttatttattttgattattcattttctgactcatgcatgttttttgttcataa |
39600789 |
T |
|
| Q |
114 |
tctgcagccatttggaactgttcctgtaataaaagatggagactataccctttatggttaagacatcttgaccccatgtcatgctttttcaacttcttgt |
213 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
39600790 |
tctgcagccttttggaactgttcctgtaataaaagatggagactataccctttatggttaaaacatcttgaccccatgtcatactttttctacttcttgt |
39600889 |
T |
|
| Q |
214 |
ttttc |
218 |
Q |
| |
|
||||| |
|
|
| T |
39600890 |
ttttc |
39600894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 103 - 201
Target Start/End: Original strand, 39611215 - 39611312
Alignment:
| Q |
103 |
tttgttcacaatctgcagccatttggaactgttcctgtaataaaagatggagactataccctttatggttaagacatcttgaccccatgtcatgctttt |
201 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39611215 |
tttgttcataatctgcagccatttggaaatgttcctgttattaaagatggagactataccctttatggttaa-acatcttgaccccatgtcatgctttt |
39611312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University