View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4049_low_27 (Length: 255)
Name: NF4049_low_27
Description: NF4049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4049_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 252
Target Start/End: Original strand, 40902661 - 40902904
Alignment:
| Q |
9 |
agcacagaaactgtctgcatccgatggtgtgcagaactggaaatggagttggagtccaaatctgaaccatgaagaaaatcagcctgctgttgaactggtc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40902661 |
agcacagaaactgtctgcatccgatggtgtgcagaactggaaatggagttggagtcgaaatctgaaccatgaagaaaatcagcctgctgttgaactggtc |
40902760 |
T |
 |
| Q |
109 |
attgccctgcctacagtgcagctgcaggaaggcgtgacacatacgtttaaatacggaagattacattggcttctcggttacgtttaagtacggaagatta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
40902761 |
attgccctgcctacagtgcagctgcaggaaggcgtgacacatacgtttaaatacggaagattacattggtttctcagttacgtttaagtacggaagatta |
40902860 |
T |
 |
| Q |
209 |
catcggtttctcagttaaataccgtttatattctgctctgtggt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40902861 |
catcggtttctcagttaaataccgtttatattctgctctgtggt |
40902904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 9 - 95
Target Start/End: Original strand, 30149590 - 30149676
Alignment:
| Q |
9 |
agcacagaaactgtctgcatccgatggtgtgcagaactggaaatggagttggagtccaaatctgaaccatgaagaaaatcagcctgc |
95 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
30149590 |
agcacagaaactgtatgagaccgatggtgtgcagaactggaaatgaagttggagtcgaaatctgaaccatgaacaaaatctgcctgc |
30149676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University