View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4049_low_35 (Length: 242)
Name: NF4049_low_35
Description: NF4049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4049_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 79 - 225
Target Start/End: Complemental strand, 26010125 - 26009979
Alignment:
| Q |
79 |
cttatcaaactgacaaatattacttttctatagatgatggatatcatttttgtaaatannnnnnnattgaaaaataattgcatccttgttgaataatatt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26010125 |
cttatcaaactgacaaatattacttttctatagatgatggatatcatttttgtaaatatttttttattgaaaaataatggcatccttgttgaataatatt |
26010026 |
T |
|
| Q |
179 |
tgactactttcagcttctttgcttttcctttgctgctatgcacgttg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26010025 |
tgactactttcagcttctttgcttttcctttgctgctatgcacgttg |
26009979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 26010201 - 26010167
Alignment:
| Q |
1 |
ctcacagcatatctcgaatatataatctttaactt |
35 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
26010201 |
ctcacagcatgtctcgaatatataatctttaactt |
26010167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University