View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4049_low_36 (Length: 242)
Name: NF4049_low_36
Description: NF4049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4049_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 3125027 - 3125256
Alignment:
| Q |
1 |
ttttttgttttaatcggatattctttgctcacaacaagtgaaactaatccctagagttgggtagtaacacattaagcaacaaaactatatctcaagagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3125027 |
ttttttgttttaatcggatattctttgctcacaacaagtgaaactaatccctagagttgggtagtaacacattaggcaacaaaactatatctcaagagtg |
3125126 |
T |
|
| Q |
101 |
ttaatgttgctcattcttaggtaagtgtttgaaac-tttgacttttggttaagctaaaaaagacttttatcatctcatttaaatgctcttgaatctattt |
199 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3125127 |
ttaatgttgttcattcttaggtaagtgtttgaaacttttgacttttggttaagctaaaaaagacttttatcatctcatttaattgctcttgaatctattt |
3125226 |
T |
|
| Q |
200 |
ttggttaatcgttttatttgttcacaggtt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3125227 |
ttggttaatcgttttatttgttcacaggtt |
3125256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University