View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4049_low_42 (Length: 239)
Name: NF4049_low_42
Description: NF4049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4049_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 12 - 146
Target Start/End: Complemental strand, 3786903 - 3786770
Alignment:
| Q |
12 |
atcatcattggtccctcaactcgggataaatcttcttgaagtgaacgatcttgtgataatagaaacaattcaacatggcaccaccctttgannnnnnnnn |
111 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3786903 |
atcatcattgatccctcaactcgggataaatcttcttgaagtgaacgatcttgtgataatagaaacaattcaacatggcaccaccctttga-tttttttt |
3786805 |
T |
|
| Q |
112 |
nncttccttattctctctagtttcatttctctcta |
146 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
3786804 |
ttcttccttattctctctagtttcatttctttcta |
3786770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 187 - 239
Target Start/End: Complemental strand, 3786702 - 3786650
Alignment:
| Q |
187 |
caaggttcaccaagttgtcaatgatattggtaaactgtatcaattgttttgtt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3786702 |
caaggttcaccaagttgtcaatgatattggtaaactgtatcaattgttttgtt |
3786650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University