View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4049_low_43 (Length: 238)

Name: NF4049_low_43
Description: NF4049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4049_low_43
NF4049_low_43
[»] chr8 (1 HSPs)
chr8 (1-84)||(4362504-4362593)


Alignment Details
Target: chr8 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 4362593 - 4362504
Alignment:
1 tatcccttctgtattagatatctaccctaatc-----ggcctttagggccaattccttatttgaaatg-aaactcaactatttttacaag 84  Q
    ||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||| |||||||||||||||||||||    
4362593 tatcccttctgtattagatatctaccctaatcggcccggcctttagggccaattccttatttgaaatgaaaactcaactatttttacaag 4362504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University