View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4049_low_52 (Length: 211)
Name: NF4049_low_52
Description: NF4049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4049_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 10 - 193
Target Start/End: Complemental strand, 8353204 - 8353021
Alignment:
| Q |
10 |
tgaaattgaaattgaggagttaagatcaaaaaggtactacaatatatacaagaatgcatgaaataaaagatagatagttaccttcttttgaaggtgtatg |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
8353204 |
tgaaattgaaattgaagagttaagatcaaaaaggtactacaatatatacaagaatgcatgaaataaataaaagatagttaccttcttttgaaggtgtatg |
8353105 |
T |
|
| Q |
110 |
gggtaatcttgccggaagaatcatgagctgcccaaccagatacagtttgtgtgtggttaggagtagtcttagccattgatatga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8353104 |
gggtaatcttgccggaagaatcatgagctgcccaaccagatacagtttgtgtgtggttaggagtagtcttagccattgatatga |
8353021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University