View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4050_low_21 (Length: 280)
Name: NF4050_low_21
Description: NF4050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4050_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 148 - 262
Target Start/End: Original strand, 8860856 - 8860972
Alignment:
| Q |
148 |
tgctattaggcagc-tgtcagtccgt-agcaacacctttaatttaaatagatttcatgtttgcaatcatatgattcatatgtagctgaaagttctaatca |
245 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8860856 |
tgctattaggcagcctgtcagtccgtgagcaacacctttaatttaaatagatttcatgtatgcaatcatatgattcatatgtagctgaaagttctaatca |
8860955 |
T |
|
| Q |
246 |
ctttcctgtgtcccctt |
262 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
8860956 |
ctttcctgtgtcccctt |
8860972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 5 - 80
Target Start/End: Original strand, 8860713 - 8860788
Alignment:
| Q |
5 |
aagaaaaaaggacaagaagtattggaatttagctcctgatacaaagtaaacatatctctcagatgatttctttttc |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8860713 |
aagaaaaaaggacaagaagtattggaatttagctcctgatacaaagtaaacatatctctcagattatttctttttc |
8860788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University