View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4051_low_32 (Length: 253)
Name: NF4051_low_32
Description: NF4051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4051_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 235
Target Start/End: Original strand, 4168094 - 4168313
Alignment:
| Q |
17 |
cacagagagtcacaagtgcagcagtcatccacttgctgacagagtcacagctgccaatatt-gtaaagattggtgataaaagttgtaatgcaaggacagt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4168094 |
cacagagagtcacaagtgcagcagtcatccacttgctgacagagtcacagctgccaatatttgtaaagattggtgataaaagttgtaatgcaaggacagt |
4168193 |
T |
 |
| Q |
116 |
gcctgtaggtagaaggtttgccaaatgtgccgtgctctgaaatgtcgaacttatagctgtttgtatcaagtttctctttgcttctggaacctctgcattt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4168194 |
gcctgtaggtagaaggtttgctaaatgtgccgtgctctgaaatgtcaaacttatagctgtttgtatcaagtttctctttgcttctggaacctctgcattt |
4168293 |
T |
 |
| Q |
216 |
agcagtagtggaaccttgtg |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4168294 |
agcagtagtggaaccttgtg |
4168313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 17 - 232
Target Start/End: Original strand, 4179021 - 4179237
Alignment:
| Q |
17 |
cacagagagtcacaagtgcagcagtcatccacttgctgacagagtcacagctgccaatatt-gtaaagattggtgataaaagttgtaatgcaaggacagt |
115 |
Q |
| |
|
|||| |||||||||||| ||| |||||| |||||| ||||||||||||| |||||| ||| ||||| |||||||| |||||||| || || || ||||| |
|
|
| T |
4179021 |
cacatagagtcacaagtacagaagtcatggacttgcagacagagtcacagttgccaacatttgtaaaaattggtgacaaaagttggaaagccagaacagt |
4179120 |
T |
 |
| Q |
116 |
gcctgtaggtagaaggtttgccaaatgtgccgtgctctgaaatgtcgaacttatagctgtttgtatcaagtttctctttgcttctggaacctctgcattt |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| | |||| || | | |||| ||||||||||||||| ||||| |
|
|
| T |
4179121 |
gcctgtaggtagaaggtttgccaaatgcgccgtgctttgaaatgtcgaacttatagctttctgtaccaggctcctctctgcttctggaacctccgcattc |
4179220 |
T |
 |
| Q |
216 |
agcagtagtggaacctt |
232 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
4179221 |
cgcaggagtggaacctt |
4179237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University