View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4051_low_36 (Length: 239)
Name: NF4051_low_36
Description: NF4051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4051_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 102 - 232
Target Start/End: Complemental strand, 24673668 - 24673538
Alignment:
| Q |
102 |
ttaacagtaagcaacgagatctcatcgaccttaggtctaaacaaagagatctgagaattggaattggaaagcgagagtctagaatcacacggagataact |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24673668 |
ttaacagtaagcaacgagatctcatcgaccttaggtctaaacaaagagatctgagaattggaattggaaagcgagagtctagaatcacacggagataact |
24673569 |
T |
 |
| Q |
202 |
gaatgctattgttattgttgtagaataattt |
232 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
24673568 |
gaatgctattgttattgttgtagaagaattt |
24673538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University