View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4053_high_14 (Length: 279)
Name: NF4053_high_14
Description: NF4053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4053_high_14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 30 - 279
Target Start/End: Original strand, 45050623 - 45050874
Alignment:
| Q |
30 |
taaattggtatcaaagtcttgtatacacgtatcatttctattgtgtaaatcatatgaaccattcatgcttaatttttccctatgaattctagaaaaattc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45050623 |
taaattggtatcaaagtcttgtatacacatatcatctctattgtgtaaatcatatgaaccattcatgcttaatttttccctatgaattctagaaaaattc |
45050722 |
T |
 |
| Q |
130 |
aatatttgtagaagaaattgttcttatagatat--ggtctaaagatgcttcaatggagctcgtctttgtgaaaaatagtccaatttaaggtttacatgtc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45050723 |
aatatttgtagaagagattgttcttatatatatgggggctaaagatgcttcaatggagctcgtctttgtgaaaaatagtccaatttaaggtttacatgtc |
45050822 |
T |
 |
| Q |
228 |
actttctattgtcaaaattttattaaatcataacgcatgtaaaatatgatga |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45050823 |
actttctattgtcaaaattttattaaatcataacgcatgtaaaatatgatga |
45050874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University