View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4053_high_22 (Length: 220)
Name: NF4053_high_22
Description: NF4053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4053_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 11 - 210
Target Start/End: Original strand, 10566573 - 10566772
Alignment:
| Q |
11 |
cagcagagaaaagggtatttttatcaatcggtatgcttttgtcgcctgacaatgcaactaatgctgctactaaaccggtatttccagcaagtgttggctc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10566573 |
cagcagagaaaagggtatttttatcaatcggtatgcttttgtcgcctgacaatgcaactaatgctgctactaaaccggcatttccagcaagtgttggctc |
10566672 |
T |
 |
| Q |
111 |
tgtgtagttgtagttttttcgaacatcatgaaaaccatcgtgcctgtcaggaccagcaaccatggcaccaacaagaatatttggatttggctttgatgat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10566673 |
tgtgtagttgtagttttttcgaacatcatgaaaaccatcgtgcctgtcaggaccagcaaccatggcaccaacaagtatatttggatttggctttgatgat |
10566772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University