View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4053_low_20 (Length: 240)
Name: NF4053_low_20
Description: NF4053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4053_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 629580 - 629406
Alignment:
| Q |
18 |
ttattaaacaatgaaatttgcaaagttatcatactaatgtttctatttggattttggggatgaccaaactaaaagtgaatttagtgtagtcatcttcttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
629580 |
ttattaaacaatgaaatttgcaaagttatcatactaatgtttctatttggattttggggatgaccaaactaaaagtgaatttagtgcagtcatcttcttt |
629481 |
T |
 |
| Q |
118 |
cnnnnnnnnnnnnnnnnnnaatgtaagggttgcagcatagtaaccaaacaaaaagtcgacttggtgtggtcactccttaag |
198 |
Q |
| |
|
| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
629480 |
c------tttcttttttttaatgtaagggttgcagcatagtaaccaaactaaaagtcgacttggtgtggtcactccttaag |
629406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University