View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4054_high_8 (Length: 281)
Name: NF4054_high_8
Description: NF4054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4054_high_8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 7 - 281
Target Start/End: Complemental strand, 44750959 - 44750685
Alignment:
| Q |
7 |
gcagatgcatgaatgtgtatgatacaagcaacaatgtgtgctatcttggagaaaatattgcagctatatgatcaatgttttgtttagtcaatatgtacag |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44750959 |
gcagatgcatgaatgtgtacgatacaagcaacaatgtgtgctatcttggagaaaatattgcagctatatgatcaatgttttgtttagtcaatatgtacag |
44750860 |
T |
|
| Q |
107 |
tctataatgttgttttaatacttgacaaaatatgaaatgctagcaggtttttgttaatacaattatcagtttttctttactgaagcatcatagatggaac |
206 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44750859 |
tctataatgttgttttaatacttgactaaatatgaaatgctagcaggtttttgttaatacaattatcagtttttctttactgaagcatcatagatggaac |
44750760 |
T |
|
| Q |
207 |
tttcaaattatagctagaactcttataaattggctcactatatatatttttatctcaaaacggttatatttttct |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44750759 |
tttcaaattatagctagaactcttataaattggctcactatatatatttttctctcaaaacggttatatttttct |
44750685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University