View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4055_high_11 (Length: 258)
Name: NF4055_high_11
Description: NF4055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4055_high_11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 56471989 - 56471752
Alignment:
| Q |
18 |
gggtaaggaggaagatagaataataatatcatcaagatcttcatctggtggtgggttgacgttgagagagcctctccttgtgaagaataacaacaggctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56471989 |
gggtaaggaggaagatagaataataatatcatcaagatcttcatctggcgg---gttgacgttgagagagcctctccttgtgaagaataacaacaggctc |
56471893 |
T |
|
| Q |
118 |
aatactacctcccaggttgccattgttggagccaatgtttgtcaaattgaaagtcttgactacgagtatgtattgataatgacatatcatcgcttttgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56471892 |
aatactacctcccaggttgccattgttggagccaatgtttgtcaaattgaaagtcttgactacgagtatgtattgataatgacatatcatcgcttttgtt |
56471793 |
T |
|
| Q |
218 |
tcaatttttcattcattaattaatttaaccttcatgtagga |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56471792 |
tcaatttttcattcattaattaatttaaccttcatgtagga |
56471752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University