View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4055_high_8 (Length: 317)
Name: NF4055_high_8
Description: NF4055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4055_high_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 17774771 - 17774551
Alignment:
| Q |
14 |
gaaaccaggtggacaaggaggatgaatccggaattggcgtgttagtgggttacaagcgatgagggatgtcgtggttagagtttgggagattggactattg |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17774771 |
gaaaccaggtggacaaggaggatggatccggaattggcgtgttagtgggttacaagagacgagggatgtcgtggttagagtttgggagattggactattg |
17774672 |
T |
|
| Q |
114 |
ttgataccttctgcccaaaggtagatgagtccatcagaggaagctaccggaagaagggaagagaaagggagaaaattgatgcgaaaatggatccaatcat |
213 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
17774671 |
ttaataccttctgcccaaaggtagatgagtccatcagaggaagctactggaagaagggaagagaaagggagaaagttgaggggaaaatggatccaatcat |
17774572 |
T |
|
| Q |
214 |
ttaggtcaagatcgaagaaac |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
17774571 |
ttaggtcaagatcgaagaaac |
17774551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 126 - 217
Target Start/End: Original strand, 12225391 - 12225482
Alignment:
| Q |
126 |
gcccaaaggtagatgagtccatcagaggaagctaccggaagaagggaagagaaagggagaaaattgatgcgaaaatggatccaatcatttag |
217 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||| | |||||||||||||| || |||| ||||||| | ||||| |||||| |
|
|
| T |
12225391 |
gcccaaaggtagatgagtccatgagatgaagcaactggaagaggagaagagaaagggaggaagttgagaggaaaatgaagccaatgatttag |
12225482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University