View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4055_low_12 (Length: 289)
Name: NF4055_low_12
Description: NF4055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4055_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 284
Target Start/End: Original strand, 3674228 - 3674499
Alignment:
| Q |
17 |
aaccactccatagctatacacatcactctttgttgtgaggtgacctatata--atcaatcgggcaagggttaattagattnnnnnnnnntt--cttcttc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||| || |
|
|
| T |
3674228 |
aaccactccatagctatacacatcactctttgttgtgaggtgacctatatataatcaatcgggcaagggttaattagattcaaatttttttttcttcgtc |
3674327 |
T |
|
| Q |
113 |
ttaaccctcaaattatcagcgaaaacaaccctgataatctagagttcggccaggagcagcataaaacagggttaacattttgtatggtagagtcatacct |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3674328 |
ttaaccctaaaattatcagcgaaaacaatcctgataatctagagttcggccaggagcagcataaaacagggttaacattttgtatggtagagtcatacct |
3674427 |
T |
|
| Q |
213 |
gtcatgatgtactcaggagccgcataaccatgtgttcccattacgcgtgtcgttacatgtgtctctgctcct |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3674428 |
gtcatgatgtactcaggagccgcataaccatgtgttcccattacgcgtgtcgttacatgtgtctcttctcct |
3674499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University