View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4055_low_19 (Length: 218)
Name: NF4055_low_19
Description: NF4055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4055_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 53999780 - 53999601
Alignment:
| Q |
16 |
aatatataccaataatggaaggagtgttattatgataatgataaaaagaaatgtaaagctttagtgttcaattgttgtgataagtagcatgtttatcact |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53999780 |
aatatataccaataatggaaggagt----ttatgataatgataaaaagaaatgtaaagctttagtgttcaattgttgtgataagtagcatgtttatcact |
53999685 |
T |
|
| Q |
116 |
tctaaacaaaagattgaaatgtgactcaatgaatgtcaagtagtttgagaattacataatctcattaattttacaacacatata |
199 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53999684 |
tctaaacaaaagattgaaatgtgactcgatgaatgtcaagtagtttgagaattacataatctcattaattttacaacacatata |
53999601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University