View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4056_low_4 (Length: 249)
Name: NF4056_low_4
Description: NF4056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4056_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 67 - 230
Target Start/End: Original strand, 53091291 - 53091452
Alignment:
| Q |
67 |
aaatatttaatctcttaagtggtcagagagtgtgtgtctatatgtagagggagaggcagagagtgagaaacatctagtagaagatatcaacattttaaat |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53091291 |
aaatatttaatctcttaagtggtcagagagtgtgtgtctat--gtagagggagaggcagagagtgagaaacatctagtagaagatatcaacattttaaat |
53091388 |
T |
 |
| Q |
167 |
tagtaatctcatataattannnnnnnnggttgacaaatctcatataattactatataataatat |
230 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53091389 |
tagtaatctcatataattattatttttggttgacaaatctcatataattactatataataatat |
53091452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 15 - 75
Target Start/End: Original strand, 53091054 - 53091114
Alignment:
| Q |
15 |
aatattactagtctaaaataattcattttcattttgtaacacaacttgcggtaaatattta |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53091054 |
aatattactagtctaaaataattcattttcattttgtgacacaacttgcggtaaatattta |
53091114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University