View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4057_low_2 (Length: 295)
Name: NF4057_low_2
Description: NF4057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4057_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 11 - 279
Target Start/End: Complemental strand, 51822163 - 51821895
Alignment:
| Q |
11 |
cagagattcaaaaggcgaataaacttgctagtatattcgcaaggagtaaccggttaaccggtgaaataccggaagagatttctaaagcaacgtcgttggt |
110 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822163 |
cagagattcaaaaagcgaataaacttgctagtatattcgcaaggagtaaccggttaacgggtgaaataccggaagagatttctaaagcaacgtcgttggt |
51822064 |
T |
|
| Q |
111 |
atcaattgatcttagtaacaatcaaatttctgggaacattccagaaggtattggtcaacttcaacaacttggtaacctgcatttgcagggtaacaagtta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822063 |
atcaattgatcttagtaacaatcaaatttctgggaacattccagaaggtattggtcaacttcaacaacttggtaacctgcatttgcagggtaacaagtta |
51821964 |
T |
|
| Q |
211 |
acaggggtaattccggagtctttaggttattgtaactcactcaacgacgttgatctttcgagaaatgaa |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51821963 |
acaggggtaattccggagtctttaggttattgtaactcactcaacgacgttgatctttcgagaaatgaa |
51821895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University