View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4058_low_14 (Length: 218)
Name: NF4058_low_14
Description: NF4058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4058_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 61 - 169
Target Start/End: Complemental strand, 26010419 - 26010311
Alignment:
| Q |
61 |
taacattcatttcgtcaaacttctaaatttcatagaaaaaataatattgaaattatttaaggtcgttaaataaatttgcaaaagtgagcaaataaaagtt |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26010419 |
taacattcattttgtcaaacttctaaatttcatagaaaaaataatattgaaattatttaaggtcgttaaataaatttgcaaaagtgagcaaataaaagtt |
26010320 |
T |
|
| Q |
161 |
aaatctaac |
169 |
Q |
| |
|
||||||||| |
|
|
| T |
26010319 |
aaatctaac |
26010311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University