View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4059_high_4 (Length: 230)
Name: NF4059_high_4
Description: NF4059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4059_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 15 - 111
Target Start/End: Complemental strand, 4644473 - 4644377
Alignment:
| Q |
15 |
caaaggacatagttaaaatctccctcgtggacaattgcaaaatgacaatattgccactaattaataatataaatatcacatgaaaatgagggctgtt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4644473 |
caaaggacatagttaaaatctccctcgtggacaattgcaaaatgacaatattgccactaattaataatataaatatcacatgaaaatgagggctgtt |
4644377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 4644335 - 4644276
Alignment:
| Q |
153 |
tgattgacaattcaggaactgaaccgagttcggttcagttgagttcacgaattatccttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4644335 |
tgattgacaattcaggaactgaaccgagttcggttcagttgagttcacgaattatccttg |
4644276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University