View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4060_high_13 (Length: 277)
Name: NF4060_high_13
Description: NF4060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4060_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 3 - 267
Target Start/End: Original strand, 48881019 - 48881283
Alignment:
| Q |
3 |
gttatggttttcgatatacctaaggttgtccttaaagatttcaaatcgatgtactttctcacctaatgcattataaaccttaccatgcttcatcaaccac |
102 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48881019 |
gttatggttttcaatatacctaaggttgtccttaaagatttcaaatcgacgtactttctcacctaatgcattataaaccttaccatgcttcatcaaccac |
48881118 |
T |
|
| Q |
103 |
gattcatacaacttcatgaggtggttttcgttctttgcagcgtcgagttttgcatcgtaatcgatgatggacatgtctacggcaagagcaagagacaaaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48881119 |
gattcatacaacttcatgaggtggttttcgttctttgcagcatcgagttttgcatcgtagtcgatgatggacatgtctacggcaagagcaagagacaaaa |
48881218 |
T |
|
| Q |
203 |
acgaaagagaaagcacgaggacaagagagagatgtggtttttgaaagagtgccctgatgatgatg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
48881219 |
acgaaagagaaagcacgaggacaagagagagatgtggtttttgaaagagtgccatgatgacgatg |
48881283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University