View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4060_high_17 (Length: 263)
Name: NF4060_high_17
Description: NF4060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4060_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 6e-49; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 120
Target Start/End: Complemental strand, 35741405 - 35741303
Alignment:
| Q |
18 |
gatggaacgagcgtcacaaagagcacatgttgagttccttcttactgatgaattagagaatgtgggtatttgaagatgtggtgaaagtgaagtgaatgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35741405 |
gatggaacgagcgtcacaaagagcacatgttgagtttcttcttactgatgaattagagaatgtgggtatttgaagatgtggtgaaagtgaagtgaatgta |
35741306 |
T |
 |
| Q |
118 |
ttg |
120 |
Q |
| |
|
||| |
|
|
| T |
35741305 |
ttg |
35741303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 176 - 253
Target Start/End: Complemental strand, 35741297 - 35741220
Alignment:
| Q |
176 |
ctgtttgtttggtattatgtggccattgtttgtaatagtttgtgagttgggaattagtgtactcgtttactttctctg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35741297 |
ctgtttgtttggtattatgtggccattgtttgtaatagtttgtgaattgggaattagtgtactcgtttactttctctg |
35741220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 35747834 - 35747793
Alignment:
| Q |
18 |
gatggaacgagcgtcacaaagagcacatgttgagttccttct |
59 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
35747834 |
gatggaacgagcatcacaaagagcacatgttgaattccttct |
35747793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University