View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4060_high_19 (Length: 258)
Name: NF4060_high_19
Description: NF4060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4060_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 27897801 - 27898028
Alignment:
| Q |
16 |
ttttcttggctaatacgtatgtcacaaagttggtttaaggatcatcacgtgtacagtgtgccccatacaagtaaaacattttgggtaatgtcggttgggg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27897801 |
ttttcttggctaatacgtatgtcacaaagttggtttaaggatcatcacgtgtacagtgtgccccatacaagtaaaacattttgggtaatgtcggttgggg |
27897900 |
T |
|
| Q |
116 |
tatgatgcacgtgcgggttacactttcaattgacatgcagcttcaattcacaattaggtaggggaaggggagatgtacttgacttgtcaaaattatgaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
27897901 |
tatgatgcacgtgcgggttacactttcaattgacatgcagcttcaattcacaattaggtaggggaaggggagatgtacttaacttgtcaaatttatgaaa |
27898000 |
T |
|
| Q |
216 |
attaaatgtcaatgtaatatgtaatgcc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
27898001 |
attaaatgtcaatgtaatatgtaatgcc |
27898028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University