View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4060_high_20 (Length: 253)
Name: NF4060_high_20
Description: NF4060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4060_high_20 |
 |  |
|
| [»] chr7 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 253
Target Start/End: Complemental strand, 33399430 - 33399188
Alignment:
| Q |
11 |
cagagataaattggtctcctgtaccctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatggaccgctccccgacggtccctgctgca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33399430 |
cagagataaattggtctcctgtaccctcacctacaccggcccctcaagcagcaccaccttcaaatgcaccatggaccgctccccgccggtccctgctgca |
33399331 |
T |
 |
| Q |
111 |
aaagaagctattcaaaacgattcacaggaatctgataactgtttgagattggattagttcatgtgtcatgtttcaaagtggggctattttttctagtgac |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33399330 |
aaagtagctattcaaaacgattcacaggaatctgataactgtttgagattggattagttcatgtgtcatgtttcaaagtggggctattttttctagttac |
33399231 |
T |
 |
| Q |
211 |
taaaatcattaattatttattttctttatgttggtgaatttat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399230 |
taaaatcattaattatttattttctttatgttggtgaatttat |
33399188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 11 - 163
Target Start/End: Complemental strand, 33395546 - 33395394
Alignment:
| Q |
11 |
cagagataaattggtctcctgtaccctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatggaccgctccccgacggtccctgctgca |
110 |
Q |
| |
|
||||||||| ||||||||| || ||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||| |||| |||||||| |||| |
|
|
| T |
33395546 |
cagagataacttggtctccggtgccctcacctacaccgtcccctgaagtagcaccgccttcaaatgcaccatggaccgctgcccgccggtccctactgcc |
33395447 |
T |
 |
| Q |
111 |
aaagaagctattcaaaacgattcacaggaatctgataactgtttgagattgga |
163 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
33395446 |
aaagaagctattcaaaatgattcacagaaatttgatagctgtttgagattgga |
33395394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 33 - 84
Target Start/End: Complemental strand, 33395617 - 33395566
Alignment:
| Q |
33 |
accctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatgg |
84 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
33395617 |
accctcacctacaccggcccatgaagcagcaccgtcttcaaatgcaccatgg |
33395566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 84
Target Start/End: Complemental strand, 33399600 - 33399549
Alignment:
| Q |
33 |
accctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatgg |
84 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33399600 |
accctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgg |
33399549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 34 - 84
Target Start/End: Complemental strand, 33399500 - 33399450
Alignment:
| Q |
34 |
ccctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatgg |
84 |
Q |
| |
|
|||||||||||||| |||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
33399500 |
ccctcacctacaccagcccctgaagccgcacctccttcaaatgcaccatgg |
33399450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University