View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4060_low_16 (Length: 275)
Name: NF4060_low_16
Description: NF4060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4060_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 17 - 264
Target Start/End: Original strand, 365864 - 366111
Alignment:
| Q |
17 |
aagtaatgatttgagaaagtgagagtatggaaaatgtctatgagagctgtttgagatttggcgccattgttgatgagactgtggacatttgaggttatgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
365864 |
aagtaatgatttgagaaagtgagagtatggaaaatgtctatgagagctgtttgagattcggcgtcattgttgatgagactgtggacatttgaggttatgg |
365963 |
T |
 |
| Q |
117 |
ttttgaatttgttgacgaaatggaagtcgtcggaagaaattaggaggctaatgagattagggtgtttttggaagggacgagtggtggatgatgatggtta |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
365964 |
ttttgaatttgttgacgaaatggaaatcgtcagaagaaattaggaggctaatgagattagggtgtttttggaagggacgagtggtggatgatgatggtta |
366063 |
T |
 |
| Q |
217 |
taggaaagagaggttgtaatagaacgatgaaggtgttgtatgtgatga |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
366064 |
taggaaagagaggttgtaatagaacgatgaaggtgttgtatgtaatga |
366111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University