View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4060_low_25 (Length: 238)
Name: NF4060_low_25
Description: NF4060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4060_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 114 - 222
Target Start/End: Complemental strand, 38945635 - 38945527
Alignment:
| Q |
114 |
gtcgaataataatatgtgaaatacttaaattatgttaagcaaaagaccaactcattttgatttatgagtaaatttgaattcagaaaatgtcaaaaatgtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38945635 |
gtcgaataataatatgtgaaatacttaaattatgttaagcaaaagaccaactcattttgatttatgagtaaatttgaattcagaaaatgtcaaaaatgtt |
38945536 |
T |
 |
| Q |
214 |
aggttaaat |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
38945535 |
aggttaaat |
38945527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University